dna-barcoding.blogspot.com
DNA Barcoding: August 2015
http://dna-barcoding.blogspot.com/2015_08_01_archive.html
Sunday, August 30, 2015. An all taxa inventory. In partnership with the Biodiversity Institute of Ontario. And the 6th International Barcode of Life conference. Over 100 participants from over 31 institutions and 17 countries searched the rare. I was one of the participants at the BioBlitz and helped to identify a few fish, some of which belonged to species that were not previously recorded at rare. I am not a professional documentary filmmaker. Don't expect BBC or Discovery channel quality. The world's ...
brbol.org
Community | brbol.org
http://www.brbol.org/content/community-0
National Center for Biotechnology Information (NCBI). International Online Community for DNA Barcoding Professionals. European Consortium for the Barcode Of Life. Canadian Centre for DNA Barcoding. Canadian Barcode of Life Network. Biodiversity Institute of Ontario University of Guelph. Registry of Biological Repositories. The Global Biodiversity Information Facility (GBIF). UNITE - A Molecular Database for the Identification of Fungi. Papers in Fungal Barcoding. Norwegian Barcode of (NorBOL).
datanotshown.blogspot.com
Data Not Shown: 'Impact' crater
http://datanotshown.blogspot.com/2009/12/impact-crater.html
Tuesday, 1 December 2009. Tonight I attended the twitter-inspired ' Blue skies ahead? Debate in which science minister Lord Paul Drayson gamely engaged a youthful panel (and audience) of scientists on 'the prospects for UK science'. As evidenced by my flush of tweets. During and after the event, I have a lot to say about 'impact', but in this post I'm going to set aside my opinions and instead tell a personal story of how 'impact' impacted me. Specifically asked for it, I thought it might merit daylight.
datanotshown.blogspot.com
Data Not Shown: I love the NHS but not their Ramadan health FAQs
http://datanotshown.blogspot.com/2009/08/i-love-nhs-but-not-their-ramadan-health.html
Friday, 28 August 2009. I love the NHS but not their Ramadan health FAQs. The health care debate taking place in my homeland right now is immensely important. The outcome will affect all 300 million Americans, especially the 46 million that are uninsured, and if reform doesn't pass now, we probably won't get another shot at it for another decade or two. The spread of outright lies about the proposed reforms by the small but very screechy anti-reform camp ( debunked here. The sheer number of Americans- 64%.
datanotshown.blogspot.com
Data Not Shown: My first mix on 8tracks
http://datanotshown.blogspot.com/2009/09/my-first-mix-on-8tracks.html
Sunday, 6 September 2009. My first mix on 8tracks. Is a simple way to share music mixes online. Here's my first attempt:. Labels: little ol me. Subscribe to: Post Comments (Atom). About Data Not Shown. After about a year of blogging over at The Beagle Project Blog. I might be infecting the others (and the project as a whole) with Karen cooties. So, while I still consider The Beagle Project Blog my primary blogspot, the views expressed over here at Data Not Shown are mine .my own .my precious.
datanotshown.blogspot.com
Data Not Shown: September 2009
http://datanotshown.blogspot.com/2009_09_01_archive.html
Sunday, 6 September 2009. My first mix on 8tracks. Is a simple way to share music mixes online. Here's my first attempt:. Links to this post. Labels: little ol me. Subscribe to: Posts (Atom). About Data Not Shown. After about a year of blogging over at The Beagle Project Blog. You can learn more about Data Not Shown, including an explanation of the title, in my inaugural post. Follow me on Twitter. My first mix on 8tracks.
datanotshown.blogspot.com
Data Not Shown: DNA-encrypted recipes
http://datanotshown.blogspot.com/2009/06/dna-encrypted-recipes.html
Friday, 19 June 2009. This morning I woke up with an idea for a science education/outreach project in my head. The idea is borne out of a fun exchange on twitter yesterday which occurred at the tail end of a long series of frustrated tweets about some problems I'm having submitting DNA sequences to Genbank. Perhaps I should just tweet the sequences to Genbank: ctagctgctgttgaagttccatctataaatggataagactttggtcttagtatatacgagttctt. That's right, TwistedBacteria. Blackthorn ( Prunus spinosa. And that's when the...
datanotshown.blogspot.com
Data Not Shown: Saved by Science (NHM) Photo Series
http://datanotshown.blogspot.com/2009/08/saved-by-science-nhm-photo-series.html
Thursday, 27 August 2009. Saved by Science (NHM) Photo Series. I'm now six installments into a twitter photo series I've been calling "Saved by Science (NHM)" and I've decided I'm enjoying myself enough to warrant formalizing it a bit more. It all started when I was browsing SEED magazine's special Darwin bicentenary collection. As a professional Darwin groupie is wont to do) and saw a link to an article by Carl Zimmer called '. The Awe of Natural History Collections. I was immediately struck by the fami...
datanotshown.blogspot.com
Data Not Shown: December 2009
http://datanotshown.blogspot.com/2009_12_01_archive.html
Tuesday, 1 December 2009. Tonight I attended the twitter-inspired ' Blue skies ahead? Debate in which science minister Lord Paul Drayson gamely engaged a youthful panel (and audience) of scientists on 'the prospects for UK science'. As evidenced by my flush of tweets. During and after the event, I have a lot to say about 'impact', but in this post I'm going to set aside my opinions and instead tell a personal story of how 'impact' impacted me. Specifically asked for it, I thought it might merit daylight.
datanotshown.blogspot.com
Data Not Shown: "Barcode of plants mapped" identified tested
http://datanotshown.blogspot.com/2008/02/barcode-of-plants-mapped-identified.html
Tuesday, 5 February 2008. I just started a draft post (which I fully intend to decorate with ResearchBlogging. S recently besmirched icon. On the new paper that my Google alert tells me is coming out on DNA barcoding. In plants, my main area of research at the Natural History Museum. The only thing missing is. well. um. the paper. The Nature News article. Well, okay, but then this has a disturbing (if not surprising) implication: none of the 10 news reports announcing the findings could possibly be the r...
SOCIAL ENGAGEMENT